DNA Lab Tour
with Dr. Gary Silberstein
How much DNA
can dance on the head of a pin?
(or
How much DNA do you need for one test?)
The white hair above is a DNA Strand, in fact it
looks just like a rough coat terrier hair
and is about the same size.
Dr. Silberstein weighs the DNA Strand.
It weighs .001661 grams or 1,660,000 nano grams.
When the DNA is reconstituted it looks like this.
This is a two microgram sample in a plastic cetrifuge tube.
According to Dr. Silberstein, this is conservatively
enough DNA to do hundreds, if not thousands of tests.
In order to do tests, researchers use machines like this to do
PCR reactions. PCR stands for Polymerase Chain Reaction.
This is a -80 degree freezer. DNA can be stored for a very
long time in a good moisture proof deep freeze scientific freezer.
How frozen samples are stored.
To find a gene that is involved in a specific disease, scientists must search for DNA changes that are present more often in individuals who have a particular disease compared to individuals who do not have the disease.
One approach to this is to start with a gene whose function is known and that is suspected of playing a role in the disease, then compare the DNA of people who have the disease with those who do not to see if that gene is associated with the disease.
Another is to look in areas of the genome that are thought to be associated with the disease, then see if there are similarities among people who have the disease.
Yet another approach is to examine the DNA of large numbers of people with and without the disease and search the whole genome for areas that differ between the two groups.
Searching randomly through three billion base pairs of DNA for tiny changes that may be linked to disease has been difficult, time-consuming and expensive. With new technology and equipment this process will become easier and faster. Research will develop marker tests to screen an individual for some aspects of a particular disease.
A marker is like a signpost on the genetic highway — a spot that is observed in everyone and that can be used as a reference point among people. The marker itself (a SNP, for example) may or not cause the disease, medicine response or other phenotype that is being examined. In some cases, it may be directly linked to the phenotype, but it is useful as a signpost in either case.Using markers, it may be possible to predict your genetic risk of developing a certain disease, to diagnose a disease more accurately, or to predict how you most likely will respond to a medicine.
What is DNA?
Instructions that provide almost all of the information necessary for a living organism to grow and function are in the nucleus of every cell. These instructions tell the cell what role it will play in your body. The instructions are in the form of a molecule called deoxyribonucleic acid, or DNA. DNA (Deoxyribonucleic Acid) is the double stranded molucule that carries genetic instructions for making living organisms.
DNA is the chemical responsible for preserving, copying and transmitting information within cells and from generation to generation. The DNA molecule consists of two ribbon-like strands that wrap around each other, resembling a twisted ladder. This is often described as a double helix. DNA is contained in tightly coiled packets called chromosomesfound in the nucleus of every cell. Chromosomes consist of the double helix of DNA wrapped around proteins.
The twisted ladder is made up of repeating units called nucleotides, each of which is a single building block of DNA. Nucleotides are composed of one sugar-phosphate molecule (the linear strands or outer rails of the ladder) and one base. DNA consists of two nucleotide strands joined by weak chemical bonds between the two bases, forming base pairs. A base pair is a rung or step on the ladder of the DNA. The bases are called A (for adenine), C (for cytosine), T (for thymine) and G for guanine.
These bases always pair up in the following way:
·
A+T
· C+G
A single
strand of DNA is made of letters:
ATGCTCGAATAAATGTGAATTTGA
The
letters make words:
ATG CTC GAA TAA ATG TGA ATT TGA
The
words make sentences:
<ATG CTC GAA TAA> <ATG TGA ATT TGA>
These
"sentences" are called genes. Genes tell the cell to make
other molecules called proteins. Proteins are required for the structure,
function, and regulation of the body's cells, tissues, and organs.
We have approximately three billion base pairs (6 billion bases total)
of DNA in most of our cells. This complete set of genes is called a
genome. With the exception of identical twins, the sequence of the bases
is different for everyone, which makes each of us unique.
Chromosome: a very long DNA molecule and associated proteins, that carry portions of the hereditary information of an organism. A chromosome is formed from a single DNA molecule that contains many genes.
Genes: A gene can be defined as a region of DNA that controls a hereditary characteristic. It usually corresponds to a sequence used in the production of a specific protein or RNA.
A gene carries biological information in a form that must be copied and transmitted from each cell to all its progeny. This includes the entire functional unit: coding DNA sequences, non-coding regulatory DNA sequences, and introns.
The number of genes on a chromosome varies with the length of the chromosome.
Genes can be as short as 1000 base pairs or as long as several hundred thousand base pairs. It can even be carried by more than one chromosome.
The relative mapping of cells, chromosomes and genes illustrated by comparing them to the relative mapping of features on Earth.
Developed by BSCS, in collaboration with the American Medical Association, under the United States Department of Energy Grant# DE-FGO2-91ER61147.
From:"Mapping and Sequencing the Human Genome: Science, Ethics, and Public Policy." Developed by BSCS, in collaboration with the American Medical Association, under the United States Department of Energy Grant# DE-FGO2-91ER61147.
